PCR Marker Page


    Genetic map information
Linkage group R4
Position (cM) 0.000
Physical position 10,367,176


    Marker information
Marker type SSR
SNP name RsSSR197
Scaffold name R1S00028
SNP position 10,367,176


    Primer sequence information
Forward primer ACGGTAAAGGAGCCATTGGT
Reverse Primer TCAAAGTCGACTGGTTTCCA